MétaCan
Menu
Retour à la cohorte
Enregistrement W6949321681 · doi:10.5281/zenodo.14953292

Cubus montywoodi Zuniga, Valerio & Hanson 2025, sp. nov.

2025· article· en· W6949321681 sur OpenAlexaboutno aff

Notice bibliographique

RevueZenodo (CERN European Organization for Nuclear Research) · 2025
Typearticle
Langueen
DomaineImmunology and Microbiology
ThématiqueBird parasitology and diseases
Établissements canadiensnon disponible
Organismes subventionnairesnon disponible
Mots-clésDorsumBlack maleOcciputFace (sociological concept)Sternum

Résumé

récupéré en direct d'OpenAlex

Cubus montywoodi Zúñiga, Valerio & Hanson, sp. nov. (Figs. 3, 8, 25) Diagnostic description. Female. Fore wing length 5.1–7.5 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 26–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.5 or 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with black mark somewhat variable, either an elongate triangular black mark that narrows posteriorly, or chalice-shaped; tergite I completely yellow, without obvious black mark. Male. Similar to female. Comments: Cubus montywoodi and C johnstiremani. are the only species having the legs completely yellow, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum (Fig. 25 vs Fig. 23). In one specimen (DHJPAR0046772, reared from Herpetogramma Janzen 07) the black mark on the occiput is small, not reaching laterally beyond inner eye margin, and the black mark on the propodeum is a narrow triangle not reaching the posterior margin. Because there are only three specimens of C. montywoodi it is difficult to judge whether this deviant specimen is a distinct species or represents extreme intraspecific variation. Hosts. This species was found in the Rincon Rain Forest Sector. It has been reared on 3 occasions from Desmia ploralis DHJ 01, Herpetogramma Janzen 07, and spiloBioLep01 BioLep375 (Crambidae) feeding on Psychotria panamensis, Sabicea panamensis (Rubiaceae), and Casearia arborea (Salicaceae). Etymology. This species is named in honor of the late Monty Wood, formerly of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory. Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0017255. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 07- SRNP-40486. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Rincon Rain Forest, Puente Rio Negro, 10.90376, -85.30274, 340m (Minor Carmona) caterpillar feeding on Casearia arborea (Salicaceae) coll. 16. ii.2007 wasp eclosed 18.iii.2007. Paratypes. 2 ♀, (MNCR). COSTA RICA, ACG database codes: (♀); 12-SRNP-67073: DHJPAR0046772 (♀), 09-SRNP-44112: DHJPAR0035164 (♀). Barcode. DNA barcode of female holotype DHJPAR0017255 (660 bp): ATATTATATTTTATTTTAGGAATTTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTAA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACACGCATTTTTAATAAT TTTTTTTTTAGTAATACCTACAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTCTACCTCCTTCAATAATTTTACTATTATTAAGTAGAA TTATAAATCAAGGTCCAGGTACTGGATGAACAGTATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTTTCTCTTCATATTGCAGGATCCTCTTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTCTAGCTGTACCTATTCTTGCAGGAGCATTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTTTTTGACCCCTCAGGTGGAGGAGATCCAATTCTTTTCCAACATTTATTT

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction machine sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.

score de la tête « metaresearch » (Codex)0,000
score de la tête « metaresearch » (Gemma)0,000
Version: metacan-v3-hybrid-931329e0061cStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Observationnel · Signal consensuel: aucune
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,067
Score d'incertitude au seuil0,134

Scores du classifieur distillé par catégorie (deux têtes)

CatégorieCodexGemma
Métarecherche0,0000,000
Méta-épidémiologie (sens strict)0,0010,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0010,001
Études des sciences et des technologies0,0010,001
Communication savante0,0010,001
Science ouverte0,0010,001
Intégrité de la recherche0,0010,001
Charge utile insuffisante (le modèle a refusé de juger)0,0060,003

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,023
Tête enseignante GPT0,259
Écart entre enseignants0,236 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeObservationnel
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations0
Publié2025
Routes d'admission1
Résumé présentoui

Explorer davantage

Même revueZenodo (CERN European Organization for Nuclear Research)Même sujetBird parasitology and diseasesTravaux en français237 207