Cubus montywoodi Zuniga, Valerio & Hanson 2025, sp. nov.
Bibliographic record
Abstract
Cubus montywoodi Zúñiga, Valerio & Hanson, sp. nov. (Figs. 3, 8, 25) Diagnostic description. Female. Fore wing length 5.1–7.5 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 26–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.5 or 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with black mark somewhat variable, either an elongate triangular black mark that narrows posteriorly, or chalice-shaped; tergite I completely yellow, without obvious black mark. Male. Similar to female. Comments: Cubus montywoodi and C johnstiremani. are the only species having the legs completely yellow, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum (Fig. 25 vs Fig. 23). In one specimen (DHJPAR0046772, reared from Herpetogramma Janzen 07) the black mark on the occiput is small, not reaching laterally beyond inner eye margin, and the black mark on the propodeum is a narrow triangle not reaching the posterior margin. Because there are only three specimens of C. montywoodi it is difficult to judge whether this deviant specimen is a distinct species or represents extreme intraspecific variation. Hosts. This species was found in the Rincon Rain Forest Sector. It has been reared on 3 occasions from Desmia ploralis DHJ 01, Herpetogramma Janzen 07, and spiloBioLep01 BioLep375 (Crambidae) feeding on Psychotria panamensis, Sabicea panamensis (Rubiaceae), and Casearia arborea (Salicaceae). Etymology. This species is named in honor of the late Monty Wood, formerly of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory. Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0017255. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 07- SRNP-40486. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Rincon Rain Forest, Puente Rio Negro, 10.90376, -85.30274, 340m (Minor Carmona) caterpillar feeding on Casearia arborea (Salicaceae) coll. 16. ii.2007 wasp eclosed 18.iii.2007. Paratypes. 2 ♀, (MNCR). COSTA RICA, ACG database codes: (♀); 12-SRNP-67073: DHJPAR0046772 (♀), 09-SRNP-44112: DHJPAR0035164 (♀). Barcode. DNA barcode of female holotype DHJPAR0017255 (660 bp): ATATTATATTTTATTTTAGGAATTTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTAA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACACGCATTTTTAATAAT TTTTTTTTTAGTAATACCTACAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTCTACCTCCTTCAATAATTTTACTATTATTAAGTAGAA TTATAAATCAAGGTCCAGGTACTGGATGAACAGTATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTTTCTCTTCATATTGCAGGATCCTCTTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTCTAGCTGTACCTATTCTTGCAGGAGCATTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTTTTTGACCCCTCAGGTGGAGGAGATCCAATTCTTTTCCAACATTTATTT
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.001 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.001 | 0.001 |
| Science and technology studies | 0.001 | 0.001 |
| Scholarly communication | 0.001 | 0.001 |
| Open science | 0.001 | 0.001 |
| Research integrity | 0.001 | 0.001 |
| Insufficient payload (model declined to judge) | 0.006 | 0.003 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".