Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat
Bibliographic record
Abstract
Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study. The LMW-GS gene located at the Glu-D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3-LMWGS1 (AY263369), contains the endosperm-specific-expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3-LMWGS1 with other reported LMW-GS genes located at different Glu-3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW-GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3-LMWGS1 with the sequences of 12 group LMW-GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW-GS group 10 (identity 99.67%). The deduced LMW-GS contains nine cystine residues, which contained one more cystine residue in the C-terminal conserved domain than previous reported. This was the first LMW-GS gene encoding for a LMW-GS with 9 cystine residues that has been discovered so far.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.001 | 0.001 |
| Meta-epidemiology (narrow) | 0.002 | 0.001 |
| Meta-epidemiology (broad) | 0.001 | 0.001 |
| Bibliometrics | 0.001 | 0.001 |
| Science and technology studies | 0.001 | 0.001 |
| Scholarly communication | 0.000 | 0.001 |
| Open science | 0.001 | 0.001 |
| Research integrity | 0.001 | 0.002 |
| Insufficient payload (model declined to judge) | 0.008 | 0.006 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".