First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of <i>Apioplagiostoma populi</i>

Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 μm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 μm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 μm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5'GCATCGATGAAGAACGCAGC3' and 5'TCCTCCGCTTATTGATATGC3' specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.