DNA Covalent Immobilization onto Screen-Printed Electrode Networks for Direct Label-Free Hybridization Detection of p53 Sequences
Bibliographic record
Abstract
A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame distilled prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.
Codex and Gemma teacher scores by category
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.000 | 0.000 |
| Science and technology studies | 0.000 | 0.000 |
| Scholarly communication | 0.000 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.000 | 0.000 |
| Insufficient payload (model declined to judge) | 0.000 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one teacher head, not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".