MétaCan
Menu
Back to cohort
Record W2003540039 · doi:10.1021/ac051585o

DNA Covalent Immobilization onto Screen-Printed Electrode Networks for Direct Label-Free Hybridization Detection of p53 Sequences

2005· article· en· W2003540039 on OpenAlexaff
Christophe A. Marquette, M. F. Lawrence, L.J. Blum

Bibliographic record

VenueAnalytical Chemistry · 2005
Typearticle
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicAdvanced biosensing and bioanalysis techniques
Canadian institutionsConcordia University
Fundersnot available
KeywordsChemistryElectrodeLinkerBiochipCovalent bondHybridization probeWorking electrodeCombinatorial chemistryElectrochemistryAnalytical Chemistry (journal)NanotechnologyDNAChromatographyOrganic chemistryMaterials science

Abstract

fetched live from OpenAlex

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame distilled prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: codex-gemma-dda1882f352aValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Bench or experimental · Consensus signal: Bench or experimental
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.259
Threshold uncertainty score0.653

Codex and Gemma teacher scores by category

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0000.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0000.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.009
GPT teacher head0.271
Teacher spread0.262 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one teacher head, not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designBench or experimental
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations61
Published2005
Admission routes1
Has abstractyes

Explore more

Same venueAnalytical ChemistrySame topicAdvanced biosensing and bioanalysis techniquesFrench-language works237,207