Analysis of <i>NF1</i> transcriptional regulatory elements
Bibliographic record
Abstract
Mutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue- and developmentally-specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5' upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5' upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5' upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24-bp sequence (acttccggtggggtgtcatggcgg) that lies 310-333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1-bp in Fugu, may contain the core promoter element for NF1 transcription.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.000 | 0.000 |
| Science and technology studies | 0.000 | 0.000 |
| Scholarly communication | 0.000 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.000 | 0.000 |
| Insufficient payload (model declined to judge) | 0.001 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".