MétaCan
Menu
Back to cohort
Record W2105659507 · doi:10.1139/w11-089

Development of a SCAR marker for detection of<i>Bipolaris sorokiniana</i>causing spot blotch of wheat

2011· article· en· W2105659507 on OpenAlexvenueno aff
Rashmi Aggarwal, Suman Gupta, Sagar Banerjee, Vidya Singh

Bibliographic record

VenueCanadian Journal of Microbiology · 2011
Typearticle
Languageen
FieldAgricultural and Biological Sciences
TopicMycotoxins in Agriculture and Food
Canadian institutionsnot available
Fundersnot available
KeywordsBipolarisLeaf spotBiologySpotsHorticultureBotany

Abstract

fetched live from OpenAlex

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Bench or experimental · Consensus signal: Bench or experimental
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.001
Threshold uncertainty score0.003

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0010.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0010.000
Science and technology studies0.0000.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0010.001

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.025
GPT teacher head0.191
Teacher spread0.166 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designBench or experimental
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations38
Published2011
Admission routes1
Has abstractyes

Explore more

Same venueCanadian Journal of MicrobiologySame topicMycotoxins in Agriculture and FoodFrench-language works237,207