First Report of <i>Strawberry latent ringspot virus</i> in Strawberry in the United States and Canada
Bibliographic record
Abstract
Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5' CCTCTCCAACC-TGCTAGACT 3') and SLRSV R (5' AAGCGCATGAAGGTGTAACT 3') that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.001 | 0.001 |
| Science and technology studies | 0.004 | 0.001 |
| Scholarly communication | 0.001 | 0.000 |
| Open science | 0.001 | 0.000 |
| Research integrity | 0.000 | 0.001 |
| Insufficient payload (model declined to judge) | 0.002 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".