First Report of <i>Pepino mosaic virus</i> Infecting Tomato in Mexico
Bibliographic record
Abstract
Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5'CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5'TCTTTGTATATGGTCGCAGC) targeting the 5' portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5'AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5'CAGAAATGTGTTCAGAGGGG) targeting the 3' portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.001 | 0.000 |
| Science and technology studies | 0.001 | 0.000 |
| Scholarly communication | 0.001 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.001 | 0.001 |
| Insufficient payload (model declined to judge) | 0.003 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".