MétaCan
Menu
Retour à la cohorte
Enregistrement W2127133496 · doi:10.1074/jbc.a114.607359

HD1, a thrombin-directed aptamer, binds exosite 1 on prothrombin with high affinity and inhibits its activation by prothrombinase.

2015· article· en· W2127133496 sur OpenAlexaff
Colin A. Kretz, Alan R. Stafford, James C. Fredenburgh, Jeffrey I. Weitz

Notice bibliographique

RevueJournal of Biological Chemistry · 2015
Typearticle
Langueen
DomaineBiochemistry, Genetics and Molecular Biology
ThématiqueAdvanced biosensing and bioanalysis techniques
Établissements canadiensMcMaster University Medical Centre
Organismes subventionnairesnon disponible
Mots-clésAptamerThrombinChemistryOligonucleotideSurface plasmon resonanceBiophysicsStreptavidinMolecular biologyBiochemistryStereochemistryDNABiologyNanotechnologyBiotin

Résumé

récupéré en direct d'OpenAlex

VOLUME 281 (2006) PAGES 37477–37485 The sequences reported for the HD22 and HD23 aptamers were not correct. 1) The aptamer that we called HD23, an inactive variant of HD22 that does not bind thrombin previously named ODN 4a (Dougan, H., Weitz, J. I., Stafford, A. R., Gillespie, K. D., Klement, P., Hobbs, J. B., and Lyster, D. M. (2003) Evaluation of DNA aptamers directed to thrombin as potential thrombus imaging agents. Nucl. Med. Biol. 30, 61–72), was reported with a sequence that was missing three nucleotides. We are now calling this aptamer SV23, as shown below. However, HD23 was used in this study.AGTCCGTAATAAAGCAGGTTAAAATGACT(HD23) AGTCCG - - -TAAAGCAGGTTAAAATGACT(SV23) 2) Instead of using the aptamer HD22 that was previously named (60–18[29]) and was reported to bind thrombin (Tasset, D. M., Kubik, M. F., and Steiner, W. (1997) Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol. 272, 688–698), we used an aptamer in which the TGG triplet at position 7–9 was duplicated. We are now calling this aptamer EV22, as shown below.AGTCCGTGG - - -TAGGGCAGGTTGGGGTGACT(HD22) AGTCCGTGGTGGTAGGGCAGGTTGGGGTGACT(EV22) To determine how this error may have affected our results, we used surface plasmon resonance to compare the thrombin binding affinity of EV22 with that of HD22. Biotin-labeled aptamers were adsorbed onto separate streptavidin-modified flow cells and active thrombin was then injected. Analyses of on- and off-rates yielded Kd values of 39 nm and 0.3 nm for EV22 and HD22, respectively. Similar values were obtained when Phe-Pro-Arg-chloromethyl ketone-inhibited thrombin was injected in place of active thrombin. The Kd value of 0.3 nm for thrombin binding to HD22 is consistent with the Kd value of 0.5 nm reported previously for 60–18[29] (Tasset et al.). Thus, EV22 exhibited 130-fold weaker thrombin binding affinity than HD22. γ-Thrombin, which lacks exosite 1, bound EV22, whereas R93E thrombin, a variant with an impaired exosite 2, did not bind EV22, so EV22 appears to exhibit the same exosite 2 specificity as HD22. Because EV22 differs from HD22 in affinity but not specificity, we conclude that these errors do not affect the interpretation of the results or the conclusions of this work.

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction distillée sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Apprise à partir de 10 348 étiquettes directes de Codex et de 10 348 étiquettes directes de Gemma. Le mode candidate est l'union des têtes enseignantes seuillées; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont ni des étiquettes humaines ni des étiquettes directes de modèles de pointe.

score de la tête « metaresearch » (Codex)0,000
score de la tête « metaresearch » (Gemma)0,000
Version: codex-gemma-dda1882f352aStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Expérimental (laboratoire) · Signal consensuel: Expérimental (laboratoire)
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,002
Score d'incertitude au seuil0,671

Scores Codex et Gemma par catégorie

CatégorieCodexGemma
Métarecherche0,0000,000
Méta-épidémiologie (sens strict)0,0000,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0000,000
Études des sciences et des technologies0,0000,000
Communication savante0,0000,000
Science ouverte0,0000,000
Intégrité de la recherche0,0000,000
Charge utile insuffisante (le modèle a refusé de juger)0,0000,000

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,023
Tête enseignante GPT0,261
Écart entre enseignants0,239 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule tête enseignante, pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeExpérimental (laboratoire)
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations53
Publié2015
Routes d'admission1
Résumé présentoui

Explorer davantage

Même revueJournal of Biological ChemistryMême sujetAdvanced biosensing and bioanalysis techniquesTravaux en français237 207