HD1, a thrombin-directed aptamer, binds exosite 1 on prothrombin with high affinity and inhibits its activation by prothrombinase.
Bibliographic record
Abstract
VOLUME 281 (2006) PAGES 37477–37485 The sequences reported for the HD22 and HD23 aptamers were not correct. 1) The aptamer that we called HD23, an inactive variant of HD22 that does not bind thrombin previously named ODN 4a (Dougan, H., Weitz, J. I., Stafford, A. R., Gillespie, K. D., Klement, P., Hobbs, J. B., and Lyster, D. M. (2003) Evaluation of DNA aptamers directed to thrombin as potential thrombus imaging agents. Nucl. Med. Biol. 30, 61–72), was reported with a sequence that was missing three nucleotides. We are now calling this aptamer SV23, as shown below. However, HD23 was used in this study.AGTCCGTAATAAAGCAGGTTAAAATGACT(HD23) AGTCCG - - -TAAAGCAGGTTAAAATGACT(SV23) 2) Instead of using the aptamer HD22 that was previously named (60–18[29]) and was reported to bind thrombin (Tasset, D. M., Kubik, M. F., and Steiner, W. (1997) Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol. 272, 688–698), we used an aptamer in which the TGG triplet at position 7–9 was duplicated. We are now calling this aptamer EV22, as shown below.AGTCCGTGG - - -TAGGGCAGGTTGGGGTGACT(HD22) AGTCCGTGGTGGTAGGGCAGGTTGGGGTGACT(EV22) To determine how this error may have affected our results, we used surface plasmon resonance to compare the thrombin binding affinity of EV22 with that of HD22. Biotin-labeled aptamers were adsorbed onto separate streptavidin-modified flow cells and active thrombin was then injected. Analyses of on- and off-rates yielded Kd values of 39 nm and 0.3 nm for EV22 and HD22, respectively. Similar values were obtained when Phe-Pro-Arg-chloromethyl ketone-inhibited thrombin was injected in place of active thrombin. The Kd value of 0.3 nm for thrombin binding to HD22 is consistent with the Kd value of 0.5 nm reported previously for 60–18[29] (Tasset et al.). Thus, EV22 exhibited 130-fold weaker thrombin binding affinity than HD22. γ-Thrombin, which lacks exosite 1, bound EV22, whereas R93E thrombin, a variant with an impaired exosite 2, did not bind EV22, so EV22 appears to exhibit the same exosite 2 specificity as HD22. Because EV22 differs from HD22 in affinity but not specificity, we conclude that these errors do not affect the interpretation of the results or the conclusions of this work.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.001 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.000 | 0.000 |
| Science and technology studies | 0.000 | 0.000 |
| Scholarly communication | 0.000 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.001 | 0.001 |
| Insufficient payload (model declined to judge) | 0.003 | 0.002 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".