Cereblon Splicing of Exon 10 Mediates IMiDs Resistance in Multiple Myeloma: Clinical Validation in the CoMMpass Trial
Bibliographic record
Abstract
Abstract Background: IMiDs neomorphe the substrates binding of CRL4_DDB1_ROC1 E3 ligase through their interaction with the adaptor protein Cereblon (CRBN) triggering the proteasomal degradation of IKZF1/IKZF3. This binding results from hydrogen bonds forming between the carbonyl residues of the IMiDs' glutarimide moiety and several amino acids within a hydrophobic pocket on the surface of CRBN. This pocket is formed by three tryptophan residues (W380, W386 and W400) mapping to CRBN c-terminus exons 10-11. Others and us, have previously shown that in vitro silencing or knock-out of CRBN is clearly associated with resistance to IMiDs, however CRBN mutations mapping to its thalidomide binding domain are rarely seen. We have previously identified through paired sequencing of the transcriptome of primary myeloma cells (pre- and post IMiDs) the expression of a CRBN mRNA splice variant (CRBN-005 or ENST00000424814) lacking exon 10. We also demonstrated that this isoform is translated into a stable protein that retains its binding to DDB1/Cul4a ligase but was no longer capable of interacting with IMiDs. Functionally, in HEK293 we have also shown that stable expression of CRBN-005 at higher levels relative to the full-length variant (CRBN-004 or ENST00000231948) abrogated IMiDs-induced degradation of Ikaros. In the current work, we validated in myeloma cell lines in vitro that the splicing of CRBN exon 10 was sufficient to reverse the cytotoxicity of lenalidomide. We also interrogated the longitudinal CoMMpass trial for the expression of CRBN-005 transcripts and its impact on survival. Methods and Results: We initially confirmed that lentiviral CRISPR mediated stable knock-out of CRBN using gRNA targeting exon 2 in the MM1S and OPM2 lenalidomide sensitive cell lines, resulted in complete resistance to IMiDs. In order to examine the role of CRBN exon 10 splicing in IMiDs resistance, we next cloned spliced CRBN-005 isoform (Δ10-CRBN) or full length CRBN (WT-CRBN) into lentiviral plasmid pLX304 and stably transduced JJN3 and KMS28BM myeloma cells. The Δ10-CRBN plasmid expressed a ~ 45 kDa proteins detectable by western blotting with CRBN65 antibody (Celgene, binds aa 65-76). Stable expression of Δ10-CRBN in JJN3 and KMS28BM cells significantly reduced Aiolos and Ikaros degradation in response to lenalidomide treatment and partially reversed (~ 30%) KMS28BM cell death (JJN3 are resistant to lenalidomide despite IKZF1 degradation). Consistent with our previous studies in HEK293 cells, high expression of Δ10-CRBN relative to endogenous WT-CRBN was required for the reversal of lenalidomide effects. Furthermore, we used the CRIPSR technology to induce splicing of endogenous CRBN exon 10 using two lentiviral gRNAs targeting intron9-exon10 (TTTATCCTTATGTGGGCCGA) and exon10-intron10 junctions (CAGAACACAGCTGGTTTCCT) in lenalidomide-sensitive MM1S and OPM2 cells stably engineered to express Cas9. Single cell clones expressing the exon 10 spliced CRBN were identified by cDNA cloning and sanger sequencing. The viability of the clones in response to lenalidomide as well as Ikaors degradation were nearly fully reversed in comparison to Cas9 only expressing MM1S and OPM2 cells. Lastly, in order to clinically validate the role of Δ10-CRBN in IMiDs resistance we interrogated the transcriptome of patients enrolled in the CoMMpass trial where in addition to genomic profiling (shallow genome long-insert sequencing, WES, RNAseq) clinical data and outcomes are captured. In the CoMMpass IA8, clinical and molecular data is available on 549 subjects, of which 486 were identified as ever receiving IMiDs-based regimen. We analyzed the survival of these patients based on the ratio of transcript levels (TPM) of spliced CRBN (ENST00000424814) to that of full-length CRBN. Using a cut-off ratio of 0.75, the survival of patients treated with IMiDs based regimen and high levels of spliced CRBN was significantly worse (Figure). Importantly, in 20 patients were RNA was available pre- and post IMiDs, we show that the levels of the CRBN spliced variants were significantly increased at the time of disease progression (Figure boxplot). Conclusions: In the current work, we have confirmed the role CRBN exon 10 splicing in IMiDs resistance using functional in vitro validation studies and demonstrated its predictive effects on IMiDs activity in the CoMMpass clinical dataset. Figure Figure. Disclosures Neri: Celgene and Jannsen: Consultancy, Honoraria. Lonial:Celgene: Consultancy; Novartis: Consultancy; Janssen: Consultancy; Janssen: Consultancy; Celgene: Consultancy; Millenium: Consultancy; BMS: Consultancy; Novartis: Consultancy; BMS: Consultancy; Merck: Consultancy; Onyx: Consultancy; Onyx: Consultancy. Bahlis:Janssen: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; Onyx: Consultancy, Honoraria; Celgene: Consultancy, Honoraria, Other: Travel Expenses, Research Funding, Speakers Bureau; BMS: Honoraria; Amgen: Consultancy, Honoraria.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame distilled prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.
Codex and Gemma teacher scores by category
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.001 | 0.001 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.000 | 0.000 |
| Science and technology studies | 0.000 | 0.000 |
| Scholarly communication | 0.000 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.000 | 0.000 |
| Insufficient payload (model declined to judge) | 0.000 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one teacher head, not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".